dio1 b 7 mab  (Santa Cruz Biotechnology)

Journal: Nutrients

Article Title: Iodoquinoline-Biofortified Lettuce as a Safe and Bioavailable Dietary Iodine Source: In Vivo Study in Rats

doi: 10.3390/nu18010036

Figure Lengend Snippet: Relative expression of ( A ) Dio1 , ( B ) Dio2 , ( C ) Slc5a5 (NIS), and ( D ) Tpo genes in the thyroid gland of experimental rats. Results are presented as mean ± standard deviation (n = 7). Bars marked with different letters differ significantly at p ≤ 0.05. Description of experimental groups: Group #1 —rats fed the AIN-93G (control) diet; Group #2 —rats fed the AIN-93G diet with the addition of lyophilized non-biofortified lettuce, with KI from the mineral mixture providing iodine in the amount recommended for this diet; Group #3 , #4 , #5 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #3), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #4), and 5,7-diiodo-8-quinolinol (Group #5), providing iodine in the amount recommended for this diet; Group #6 , #7 , #8 —rats fed the AIN-93G diet with the addition of lyophilized iodine-biofortified lettuce in the form of potassium iodate (Group #6), 8-hydroxy-7-iodo-5-quinolinesulfonic acid (Group #7), and 5,7-diiodo-8-quinolinol (Group #8), providing iodine in an amount twice that recommended for this diet.

Article Snippet: Quantitative real-time PCR (qPCR) was performed to assess gene expression levels using TaqMan ® Gene Expression Assays (Thermo Fisher Scientific) specific for the following rat genes: Dio1 (Rn00572183_m1), Dio2 (Rn00581867_m1), Slc5a5 (Rn00583900_m1), and Tpo (Rn00571159_m1).

Techniques: Expressing, Standard Deviation, Control

Journal: Frontiers in Toxicology

Article Title: Examining in vivo effects of silychristin, a potent in vitro inhibitor of thyroid hormone transporter MCT8

doi: 10.3389/ftox.2026.1796387

Figure Lengend Snippet: Mean (±SE) (A) deiodinase 1 (DIO1) and (B) dehalogenase activity in the thyroid gland (A,B) and liver (C,D) collected from animals 24-h after the last of nine daily doses of silychristin, silybin, and silymarin mixture. Significant increases in activity of DIO1 [F(4,34) = 4.45, p = 0.0054] and DEHAL1 [F(4,34) = 2.7, p = 0.05] were limited to the high-dose group. No changes in the activity of these enzymes were evident in the liver. Mean (±SE) relative peroxidase activity (E) and iodine content (F) were not altered in the thyroid gland (all p’s > 0.32] *p < 0.05 Dunnett’s t-test after significant main effect in ANOVA. n = 10/dose group for control and silychristin, n = 4 for silybin and five for silymarin.

Article Snippet: A fully inhibited sample pool was also prepared for both enzymes to subtract background by adding a high concentration of the DIO1 inhibitor propyl-6-thiouracil (PTU, 1 mM) or the DEHAL1 inhibitor dibromotyrosine (DBT, 1 mM) (Tokyo Chemical Industry).

Techniques: Activity Assay, Control

Journal: Poultry Science

Article Title: Expression profile of thyroid hormone deiodinases in the adult laying hen ( Gallus gallus domesticus )

doi: 10.1016/j.psj.2025.106079

Figure Lengend Snippet: Expression levels of DIO1 mRNA in chicken hens. (A) Internal organs: Lu - lungs, H - heart, L - liver, K - kidney, Sp - spleen, P – pancreas. (B) Other tissues: Hyp - hypothalamus, Pit - pituitary gland, St - stomach, SI- small intestine, SM - skeletal muscles, AT - adipose tissue, Sk – skin. (C) Ovary: SWF – small white follicles 1–4 mm, LWF – large white follicles 4–8 mm, the granulosa and theca layers of preovulatory follicles F3−F1. (D) Oviduct: I - infundibulum, M - magnum, Is - isthmus, SG - shell gland, V - vagina. Each value represents the mean of the normalised relative quantity ± SEM ( n = 8), normalised to hypoxanthine phosphoribosyltransferase as a reference gene and standardised to the DIO1 mRNA expression in the thyroid gland as a control tissue. Values ​​marked with different letters are significantly different ( P < 0.05); one-way analysis of variance with Tukey’s post-hoc test.

Article Snippet: DIO1 , Deiodinase, iodothyronine type I , Gg03361636_m1 , CTTCAGTTTCATGCGAGATAACCGA , 69.

Techniques: Expressing, Muscles, Control

Journal: International Journal of Molecular Sciences

Article Title: A Genetically-Engineered Thyroid Gland Built for Selective Triiodothyronine Secretion

doi: 10.3390/ijms26157166

Figure Lengend Snippet: Expression of markers of T 3 action in the liver of ChEL-KI mice. ( A ) Expression of malic enzyme 1 (ME1). Lower panel: SDS-polyacrylamide gel electrophoresis of liver homogenates from 3-month-old ChEL-KI mice, cog / cog animals, and wild-type (WT) mice, followed by immunoblotting with anti-ME1 antibodies and anti-β-actin antibodies as indicated. Upper panel: Graph shows the densitometric quantitation of hepatic ME1 protein expression normalized to β-actin. ( B ) Expression of type-1 deiodinase (D1). Lower panel: SDS-polyacrylamide gel electrophoresis of liver homogenates from ChEL-KI mice, cog / cog animals, and WT controls, followed by immunoblotting with anti-D1 antibodies and anti-β-actin antibodies as indicated. Upper panel: Graph shows the densitometric quantitation of hepatic D1 protein expression normalized to β-actin. Each dot represents an individual animal, with circles representing females and squares representing males; n = 8–11 animals per group; mean ± SD; ns, not significant ( p > 0.05), p ; **** p < 0.0001 (one-way ANOVA with Tukey’s post hoc test).

Article Snippet: DYKDDDDK Tag rabbit mAb (D6W5B, Cell Signaling Technology, Danvers, MA, USA), rabbit monoclonal [EPR9730] to thyroglobulin Ab (Abcam, Cambridge, UK), T 3 mouse mAb (3A6, Invitrogen, Waltham, MA, USA), DIO1 (B-7) mAb (sc-515198, Santa Cruz Biotechnologies, Dallas, TX, USA), ME1 (C-6) mAb (sc-365891, Santa Cruz Biotechnologies, Dallas, TX, USA), Ki67 mAb (ab16667, Abcam, Cambridge, UK), KDEL (10C) mAb (ADI-SPA-827-D Enzo Life Sciences, Long Island, NY, USA), anti-Flag M2 mAb (F1804, MilliporeSigma, Burlington, MA, USA), β-Actin (C4) mAb (sc-47778, Santa Cruz Biotechnologies, Dallas, TX, USA), and HSP 90α/β (F-8) mAb (sc-13119, Santa Cruz Biotechnologies, Dallas, TX, USA) were used.

Techniques: Expressing, Polyacrylamide Gel Electrophoresis, Western Blot, Quantitation Assay